``what would happen if´´ questions as a key to explanation based predictions
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
Ngày tải lên :
30/03/2014, 15:20
... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94, ... the art Minerva Biotec 14, 121–128 137 Nishiura H, Shibuya Y, Matsubara S, Tanase S, Kambara T & Yamamoto T (1996) Monocyte chemotactic factor in rheumatoid arthritis synovial tissue Probably a...
- 17
- 440
- 0
Báo cáo khoa học: Nup358, a nucleoporin, functions as a key determinant of the nuclear pore complex structure remodeling during skeletal myogenesis docx
Ngày tải lên :
06/03/2014, 01:20
... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ (siNup358-2)] Transfection ... dystrophy, cardiomyopathy and Dunnigan-type partial lipodystrophy J Cell Sci 114, 4435–4445 13 Maeshima K, Yahata K, Sasaki Y, Nakatomi R, Tachibana T, Hashikawa T, Imamoto F & Imamoto N (2006) Cell-cycle-dependent...
- 12
- 454
- 0
Báo cáo khoa học: Mechanisms of amyloid fibril self-assembly and inhibition Model short peptides as a key research tool pptx
Ngày tải lên :
23/03/2014, 11:20
... is associated with major human diseases and has a clear physiological role in micro-organisms, the precise mechanism of its formation is not fully understood As most amyloid-related diseases are ... important information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had ... interface that can be interrupted by aromatic intercalation This situation is very similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized...
- 8
- 441
- 0
báo cáo hóa học:" Angiostatin anti-angiogenesis requires IL-12: The innate immune system as a key target" docx
Ngày tải lên :
18/06/2014, 15:20
... Mat Control AST/Mat AST Mat 0.00 Control AST/Mat AST Mat Control 0.05 1.0 0.8 0.015 0.01 0.010 AST/Mat AST 0.000 Mat AST/Mat AST Mat 0.00 Control AST/Mat AST Control 0.005 Mat Relative expression ... tumor escape as well as adverse cardiovascular effects [32] Immune cells appear to be key mediators of tumor escape mechanisms [33], and thus represent important clinical targets AST was the first ... keeps experimental metastasis in a dormant state [5] AST concentrations are elevated in fluids of animals harboring primary tumors [6] and other inflammatory and degenerative diseases [7,8] Following...
- 8
- 477
- 0
What Would Ben Graham Do Now? A New Value Investing Playbook for a Global Age_6 pot
Ngày tải lên :
20/06/2014, 20:20
... Figure 6.1 Biases and cross-border inefficiencies and mispricings Figure 6.2 The reputable capital key and cross-border inefficiencies Figure 6.3 The uses of reputable capital ...
- 23
- 301
- 0
Báo cáo sinh học: "The THO complex as a key mRNP biogenesis factor in development and cell differentiation" potx
Ngày tải lên :
06/08/2014, 19:21
... manuscript The work of AA’s laboratory is funded by the Spanish Ministry of Innovation and Junta de Andaluc a Published: 28 January 2010 Page of References Aguilera A: Cotranscriptional mRNP assembly: ... identified as a transcriptional activator that interacts with the SAGA transcription factor, opens up the possibility of a co-transcriptional action of THO in higher eukaryotes [9] The impact of ... development and differentiation The relevance of THO in cell physiology has been clearly shown from yeast to humans Yeast THO null mutants are sick and slow growers and THO depletion has a negative...
- 3
- 247
- 0
Báo cáo y học: "Small RNA sequencing reveals miR-642a-3p as a novel adipocyte-specific microRNA and miR-30 as a key regulator of human adipogenesis" ppt
Ngày tải lên :
09/08/2014, 23:20
... genome (release hg19) accounted for miRNAs annotated in mirBase (release 16) Other small RNA species, such as piwi-interacting RNAs (piRNAs) and small nucleolar RNAs (snoRNAs), were also identified ... renilla and firefly luciferase activities were assayed with the Dual Glo Luciferase Assay System (Promega) and measured with a luminometer (Luminoskan Ascent, Thermo Scientific, Waltham, MA, USA) ... was extracted and analyzed at day of differentiation Mature miRNA expression was evaluated using Mirscript assays (Qiagen SA) as specified by the manufacturer’s protocol Real-time PCR was performed...
- 13
- 365
- 0
Báo cáo y học: "An Avian Connection as a Catalyst to the 1918-1919 Influenza Pandemic"
Ngày tải lên :
02/11/2012, 11:12
... mammalian hosts These animals, usually pigs, act as a transformer or converters; creating a strain that can more readily infect humans Pigs can be infected with both avian and human influenza A ... effective measure we have to combat influenza is isolation and culling of infected fowls as demonstrated by the government of China, Vietnam, and Thailand As human populations continue to increase and ... happen to the influenza when it went to France The first theory that was offered was that this “Spanish flu” was actually a different disease Decades later phylogenic testing will find this to...
- 4
- 520
- 0
Using eliciting question as a technique to teach english to 11th form pupils
Ngày tải lên :
27/12/2013, 20:26
... play a very important role in every classroom Teachers can create an active learning environment by encouraging students to ask and answer questions Some ideas to make student questions and teacher ... mislead them by emphasizing less important material Phrase your questions carefully - Phrase your questions so that the task is clear to students Questions such as What about foreign affairs? ... However, having a prepared list of questions will help to assure that you ask questions appropriate for your goals and representative of the important material 3.1.4 Strategies to Make Classrooms...
- 42
- 641
- 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
Ngày tải lên :
18/02/2014, 16:20
... Q279E a- galactosidase A residual activity in patient derived cells; thus, galactose was demonstrated to be first active-site-directed pharmacologic chaperone for a lysosomal storage disease Galactose ... ameliorate Gaucher disease 19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Accelerated transport and maturation of lysosomal alpha-galactosidase A in Fabry lymphoblasts by an enzyme inhibitor Nat Med ... a- galactosidase A variants (causing another lysosomal storage disease) were shown to be folding and trafficking mutants [16] before this was explored as a possibility in GD Galactose administration increased...
- 7
- 507
- 0
Tài liệu Using Proven Sales Techniques for Selling WorkKeys as a Solution to Business doc
Ngày tải lên :
19/02/2014, 14:20
... friendly manner, graciously and courteously • That you want to help them • To see you as the solution to their problem, and not be seen as your problem • To be treated as mature adults, not as children ... loves and loses and loves again a slyly dashing war profiteer as she struggles to protect her family and beloved plantation A pig raised by sheepdogs, learns to herd sheep with a little help A cynical ... because you get your work done quickly You like to sugarcoat unpleasant experiences and rationalize bad situations into good ones You have a propensity towards narcotic addiction Twisted Apart,...
- 48
- 482
- 0